Skip to main content

Table 1 Primer sequences for PCR, real-time PCR, methylation-specific PCR (MSP), quantitative MSP (Qmsp) and bisulfite (Bis.) sequencing analysis

From: DNA methylation regulates sclerostin (SOST) expression in osteoarthritic chondrocytes by bone morphogenetic protein 2 (BMP-2) induced changes in Smads binding affinity to the CpG region of SOST promoter

Name Sequence (5′-3) Experiment
M-SOST-forward GAATAGGTCGGGTTTAGTTTC MSP, qMSP
M-SOST-reverse ACCTCCCACGTACTAACGA MSP, qMSP
U-SOST-forward GGAATAGGTTGGGTTTAGTTTT MSP, qMSP
U-SOST-reverse CACCTCCCACATACTAACAA MSP, qMSP
SOST-forward CCGGAGCTGGAGAACAACAAG RT-PCR
SOST-reverse GGTGTGCTCCGGCCAGTGC RT-PCR
Promoter SOST-forward GGGACCAATGGGATTTCTTT PCR
Promoter SOST-reverse TGAGCTCCGGCTTTTAATTG PCR
BSP SOST-forward TTATTTGTTGGTGGGGTGATAA Bis. sequencing
BSP SOST-reverse ACAAAACCCAAACCTACTCTCC Bis. sequencing