Skip to main content

Table 1 Primers used in qPCR experiments

From: Overexpression of MMP13 in human osteoarthritic cartilage is associated with the SMAD-independent TGF-β signalling pathway

  Primer sequence (5′ > 3′) Product size
SMAD3 reverse primer GGCTCGCAGTAGGTAACTGG 91 bp
SMAD3 forward primer GCATGGACGCAGGTTCTCC
TGFB1 reverse primer CTCAATTTCCCCTCCACGGC 114 bp
TGFB1 forward primer TCCTGGCGATACCTCAGCAA
MMP13 reverse primer AGGTAGCGCTCTGCAAACTGG 92 bp
MMP13 forward primer AGCTGGACTCATTGTCGGGC
BMP2 reverse primer CTTGCGCCAGGTCCTTTGAC 111 bp
BMP2 forward primer CCACCATGGTCGACCTTTAGGA
GAPDH reverse primer TCGCCCCACTTGATTTTGG 106 bp
GAPDH forward primer GCAAATTCCATGGCACCGT
  1. qPCR quantitative polymerase chain reaction