Skip to main content

Table 1 Primers sequences used for qPCR

From: Anti-TNF certolizumab pegol induces antioxidant response in human monocytes via reverse signaling

Gene Accession number Forward primer Reverse primer
gapdh J04038.1 cagcctcaagatcatcagca gtcttctgggtggcagtgat
hmox1 NM_002133.2 ggcagagggtgatagaagagg agctcctgcaactcctcaaa
IL1B NM_000576.2 aaagcttggtgatgtctggtc ggacatggagaacaccacttg