Skip to main content

Table 1 Oligonucleotide primers used for real-time polymerase chain reaction

From: From osteoarthritic synovium to synovial-derived cells characterization: synovial macrophages are key effector cells

Target gene Primers (forward and reverse) Product size (bp) GenBank accession number Primer efficiency (%)
RPS9 GATTACATCCTGGGCCTGAA ATGAAGGACGGGATGTTCAC 161 NM_001013 94.5
ADAMTS4 CTGCCTACAACCACCG GCAACCAGAACCGTCC 293 NM_005099.4 99.1
ADAMTS5 GCACTTCAGCCACCATCAC AGGCGAGCACAGACATCC 187 NM_007038.3 92.4
MMP13 TCACGATGGCATTGCT GCCGGTGTAGGTGTAGA 277 NM_002427 94.5
S100A8 TAGAGACCGAGTGTCCTCA CGCCCATCTTTATCACCAGA 126 NM_002964.4 93.4
S100A9 CCATCATCAACACCTTCCACCA CTGCTTGTCTGCATTTGTGTCC 179 NM_002965.3 91.4