Skip to main content

Table 2 Primers used for quantitative polymerase chain reactions

From: Different expression of β subunits of the KCa1.1 channel by invasive and non-invasive human fibroblast-like synoviocytes

Subunit Accession number Sense (forward) 5′-3′ Antisense (reverse) 3′-5′ Base pair
α NM_002247 GCTCAAGTACCTGTGGACCG CTGGTTTGAGAGTGCCATCC 104
β1 NM_004137 CTGTACCACACGGAGGACAC GCTCTGACCTTCTCCACGTC 107
β2a NM_181361 ATTAAGCGTGGCTTTTGAGG GTTGGTCCAGGGTCTCCTTT 98
β2b NM_005832 GAGAAAGAGCAACAAAGCGG TTAGCAAATCCCAGACATTGC 107
β3a NM_171828 AAATCACACTTCAGGGCAGC GCACATCTAGTGGGTCTCCA 105
β3b NM_171829 TCTGAGTGTGAGGGGCTCTT GCACATCTAGTGGGTCTCCA 105
β3c NM_171830 CCATGATGGGCTTCTCAGTC GCAGTGCAGGTCGATTCTTC 100
β3d NM_014407 AGGGACGTGCAATATCCCTG GAAAGGCTGTCCTGTGTCTCGT 351
β3e NM_001163677 ACCCGTGTCTTCAGGTGTTT TCTGTAACATCACGCTTGGGA 107
β4 NM_014505 CTGAGTCCAACTCTAGGGCG GATTTTCTCTCTTACAGGGAGGG 96
GAPDH NM_002046 AAGGTGAAGGTCGGAGTCAA AATGAAGGGGTCATTGATGG 108
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase