Skip to main content

Table 1 Primers used for QPCR

From: Inflammatory conditions partly impair the mechanically mediated activation of Smad2/3 signaling in articular cartilage

Gene Full gene name Ref seq Product length Forward 5′-- > 3′ Reverse 5′-- > 3′
bAlk5 bovine transforming growth factor, beta receptor 1 NM_174621.2 75 CAGGACCACTGCAATAAAATAGAACTT TGCCAGTTCAACAGGACCAA
bGapdh bovine glyceraldehyde 3-phosphate dehydrogenase NM_001034034.2 90 CACCCACGGCAAGTTCAAC TCTCGCTCCTGGAAGATGGT
bJunB bovine jun B proto-oncogene NM_001075656.1 139 CCTTCTACCACGACGACTCA CCGGGTGCTTTGAGATTTCG
bRps14 bovine ribosomal protein S14 NM_001077830.2 125 CATCACTGCCCTCCACATCA TTCCAATCCGCCCAATCTTCA
bSerpine1 bovine plasminogen activator inhibitor type 1 NM_174137.2 55 CGAGCCAGGCGGACTTC TGCGACACGTACAGAAACTCTTGA
bSmad7 bovine SMAD family member 7 NM_001192865.1 72 GGGCTTTCAGATTCCCAACTT CTCCCAGTATGCCACCACG
bTgfb1 bovine transforming growth factor, beta 1 NM_001166068.1 80 GGTGGAATACGGCAACAAAATCT GCTCGGACGTGTTGAAGAAC
bTgfbr2 bovine transforming growth factor beta receptor II NM_001159566.1 141 GGCTGTCTGGAGGAAGAATGA GTCTCTCCGGACCCCTTTCT
hALK5 human transforming growth factor, beta receptor 1 NM_001306210.1 65 CGACGGCGTTACAGTGTTTCT CCCATCTGTCACACAAGTAAA
hGAPDH human glyceraldehyde 3-phosphate dehydrogenase NM_001289745.1 143 ATCTTCTTTTGCGTCGCCAG TTCCCCATGGTGTCTGAGC
hSERPINE1 human plasminogen activator inhibitor type 1 NM_000602.4 213 GTCTGCTGTGCACCATCCCCCATC TTGTCATCAATCTTGAATCCCATA
hTGFB1 human transforming growth factor, beta 1 NM_000660.5 59 GAGGTCACCCGCGTGCTA TGCTTGAACTTGTCATAGATTTCGTT