Skip to main content

Table 1 List of oligonucleotide primer sequence

From: Suppression of the inflammatory response by disease-inducible interleukin-10 gene therapy in a three-dimensional micromass model of the human synovial membrane

Oligo description Sequence (5′ → 3′)
MCS_oligoA TCGAGACCGGTACTAGTGTTTAAACAGCGCTGGCGCGCCGTCGACGTTAACG
MCS_oligoB CTAGCGTTAACGTCGACGGCGCGCCAGCGCTGTTTAAACACTAGTACCGGTC
RPL22_prom_FW TTTTACTAGTGGCGGCCTGGCTACAGCAAA
RPL22_prom_RV TTTTGGATCCGGCGGCAGCGGAGTTAGAAAG
GAPDH_qPCR_FW ATCTTCTTTTGCGTCGCCAG
GAPDH_qPCR_RV TTCCCCATGGTGTCTGAGC
SOCS3_qPCR_FW TCGGACCAGCGCCACTT
SOCS3_qPCR_RV CACTGGATGCGCAGGTTCT
TNFa_qPCR_FW TCTTCTCGAACCCCGAGTGA
TNFa_qPCR_RV CCTCTGATGGCACCACCAG
IL-1b_qPCR_FW TGGGTAATTTTTGGGATCTACACTCT
IL-1b_qPCR_RV AATCTGTACCTGTCCTGCGTGTT