Skip to main content

Table 1 Primer and probe sequences for quantitative RT-PCR

From: Catabolic and proinflammatory effects of leptin in chondrocytes are regulated by suppressor of cytokine signaling-3

Gene Oligunucleotide Sequence Conc. (nM)
  Forward primer GCATGGCCTTCCGTGTTC 300
Mouse GAPDH Reverse primer GATGTCATCATACTTGGCAGGTTT 300
  Probe TCGTGGATCTGACGTGCCGCC 150
  Forward primer GCGGGCACCTTTCTTATCC 300
Mouse SOCS-3 Reverse primer AAGCTGCCCCCCTCACA 300
  Probe CTCGGACCAGCGCCACTTCTTCA 150
  Forward primer CCTGGTACGGGCATTGCT 300
Mouse iNOS Reverse primer GCTCATGCGGCCTCCTT 300
  Probe CAGCAGCGGCTCCATGACTCCC 150
  Forward primer TCGGAGGCTTAATTACACATGTTC 900
Mouse IL-6 Reverse primer CAAGTGCATCATCGTTGTTCATAC 300
  Probe CAGAATTGCCATTGCACAACTCTTTTCTCA 200
  Forward primer TTGTGTTTGCAGAGCACTACTTGA 900
Mouse MMP-13 Reverse primer AACTGTGGAGGTCACTGTAGACTTCTT 900
  Probe CATCCTGCGACTCTTGCGGGAATC 250
  1. SOCS-3 suppressor of cytokine signaling-3, iNOS inducible nitric oxide synthase, IL-6 interleukin-6, MMP-13 matrix metalloproteinase-13, Conc. concentration