Skip to main content

Table 1 Sequence and efficiency of the primers used in this study

From: TGFβ1-induced SMAD2/3 and SMAD1/5 phosphorylation are both ALK5-kinase-dependent in primary chondrocytes and mediated by TAK1 kinase activity

Gene NCBI reference sequence P (bp) E (%) Forward primer Reverse primer
bGapdh NM_001034034.2 90 101 CACCCACGGCAAGTTCAAC TCTCGCTCCTGGAAGATGGT
bRps14 NM_001077830.2 125 105 CATCACTGCCCTCCACATCA TTCCAATCCGCCCAATCTTCA
bAlk1 NM_001083479.1 109 100 ACAACACAGTGCTGCTCAGACA TGCTCGTGGTAGTGCGTGAT
bAlk2 NM_176663.3 61 105 CGTTGGAGACAGCACTTTAGCA AGAGCCGCTTCCCGATGTA
bAlk3 NM_001076800.1 142 96 GAGCAAGATGAAGCATTTATTCCA CAACCTGCCGAACCATCTG
bAlk5 NM_174621.2 75 94 CAGGACCACTGCAATAAAATAGAACTT TGCCAGTTCAACAGGACCAA
bSerpine1 NM_174137.2 55 99 CGAGCCAGGCGGACTTC TGCGACACGTACAGAAACTCTTGA
bId1 NM_001097568.2 73 107 GCTCCGCTCAGCACTCTCAA GATCGTCCGCTGGAACACA
bMmp3 NM_001206637.1 130 106 GAATCTGTGCCTCCCGAACC TCCTGAAAGATTTCCGCCAA
bSmad7 NM_001192865.1 72 98 GGGCTTTCAGATTCCCAACTT CTCCCAGTATGCCACCACG
bTgfb1 NM_001166068.1 80 107 GGTGGAATACGGCAACAAAATCT GCTCGGACGTGTTGAAGAAC
bJunb NM_001075656.1 139 97 CCTTCTACCACGACGACTCA CCGGGTGCTTTGAGATTTCG
bNgf NM_001099362.1 110 85 CAGCTCTTTTGATCGGCATACA TGTGTCAAGGGAATGCTGAAGT
bFn1 NM_001163778.1 95 96 GCACCACTCCCGACATTACT CTGATCGGCATGGACCACTT
bCol2a1 NM_001001135.2 60 97 TGATCGAGTACCGGTCACAGAA CCATGGGTGCAATGTCAATG
  1. P is product length in base pairs, E is efficiency in percentage. Alk1 is also known as Acvrl1, Alk2 as Acvr1, Alk3 as Bmpr1a and Alk5 as Tgfbr1