Skip to main content

Table 1 List of oligonucleotides

From: Effect of tryptase inhibition on joint inflammation: a pharmacological and lentivirus-mediated gene transfer study

Gene symbol Strand Sequence (5’-3’) bp Accession number
Spag11c Forward CTTACCACGAGCCTGAAC 139 NM_001039563
Spag11a Forward ACAGAGAGCGAGCCGTAAAA 113 NM_153115
Mcpt-6 Forward TGAGGCTTCTGAGAGTAA 403 NM_010781
  1. Gene symbols, oligonucleotide sequences, predicted base pair (bp) number for amplicons and NCBI accession numbers