Skip to main content

Advertisement

Table 1 Primers of target genes

From: High-magnitude compression accelerates the premature senescence of nucleus pulposus cells via the p38 MAPK-ROS pathway

Gene Accession number Forward (5’-3’) Reverse (5’-3’)
β-actin NM_031144.3 CCGCGAGTACAACCTTCTTG TGACCCATACCCACCATCAC
Aggrecan XM_002723376.1 ATGGCATTGAGGACAGCGAA GCTCGGTCAAAGTCCAGTGT
Collagen II NM_012929.1 GCCAGGATGCCCGAAAATTAG CCAGCCTTCTCGTCAAATCCT
P53 XM_008767773.1 CCTTAAGATCCGTGGGCGT GCTAGCAGTTTGGGCTTTCC
P16 NM_031550.1 TACCCCGATACAGGTGATGA TACCGCAAATACCGCACGA