Skip to main content

Table 1 Oligonucleotides for real-time RT-PCR

From: Role of endoplasmic reticulum stress in the protective effects of PPARβ/δ activation on endothelial dysfunction induced by plasma from patients with lupus

mRNA targets Descriptions Sense Antisense
PPARβ/δ Peroxisome proliferator-activated receptor beta CATTGAGCCCAAGTTCGAGT GGTTGACCTGCAGATGGAAT
IRE-1α Inositol-requiring 1 transmembrane kinase/endonuclease-1α GAATTCCAATGCCGGCCCGGC AAGCTTGGAGGGCGTCTGGAGTCAC
PERK Eukaryotic translation initiation factor-2α kinase 3 ATTGCATCTGCCTGGTTAC GACTCCTTCCTTTGCCTFT