Skip to main content

Advertisement

Table 1 Primer pairs used in qRT-PCR and size of PCR products

From: Anti-CD11b antibody treatment suppresses the osteoclast generation, inflammatory cell infiltration, and autoantibody production in arthritis-prone FcγRIIB-deficient mice

Gene for Forward Reverse Size
(5’ to 3’) (5’ to 3’) (bp)
RANK GCTGGCTACCACTGGAACTC GTGCAGTTGGTCCAAGGTTT 182
RANKL TGTACTTTCGAGCGCAGATG AGGCTTGTTTCATCCTCCTG 160
OPG TGAGTGTGAGGAAGGGCGTTA CCATCTGGACATTTTTTGCAAA 130
MCP-1 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG 249
CX3CL1 CGCGTTCTTCCATTTGTGTA CTGTGTCGTCTCCAGGACAA 169
RANTES TCGTGCCCACGTCAAGGAGTATTT TCTTCTCTGGGTTGGCACACACTT 107
TNFα TATGGCCCAGACCCTCAC GGTTGTCTTTGAGATCCATGC 110
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA 141
IL-17 TCTCTGATGCTGTTGCTGCT GACCAGGATCTCTTGCTGGA 346
IL-10 CAGCCGGGAAGACAATAACT GTTGTCCAGCTGGTCCTTTG 121
BAFF TTGTCCAGCAGTTTCACAGC CCGGTGTCAGGAGTTTGACT 160
IL-1β GCCCATCCTCTGTGACTCAT AGGCCACAGGTATTTTGTCG 230
BSF-3 CGAGCCTGACTTCAATCCTC TACGTCGGAGTTCAGCTGTG 185
IFNγ AAGACAATCAGGCCATCAGC ATCAGCAGCGACTCCTTTTC 225
β-actin TGGGTATGGAATCCTGTGG GTACTTGCGCTCAGGAGGAG 200
  1. RANK receptor activator of NF-κB, RANKL RANK ligand, OPG osteoprotogerin, MCP-1 monocyte chemotactic protein-1, RANTES regulated on activation, normal T cell expressed and secreted, BAFF B-cell-activating factor of the tumor-necrosis-factor family, BSF-3 B cell stimulating factor, IFN-γ interferon-γ, bp base pairs