Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The primers used for quantitative PCR

From: Mice with miR-146a deficiency develop severe gouty arthritis via dysregulation of TRAF 6, IRAK 1 and NALP3 inflammasome

  Forward sequence (5′–3′) Reverse sequence (5′–3′)
IL-1β GGGCCTCAAAGGAAAGAATC CTCTGCTTGTGAGGTGCTGA
TNF-α ACAAAGGTGCCGCTAACCACATGT ATGCTGCTGTTTCAGTCGAAGGCA
NALP3 CGTGGTTTCCTCCTTTTGTATT CGACCTCCTCTCCTCTCTTCTT
ASC TCACAGAAGTGGACGGAGTG TGTCTTGGCTGGTGGTCTCT
Caspase-1 CGTGGAGAGAAACAAGGAGTG AATGAAAAGTGAGCCCCTGAC
TRAF6 ATTTCATTGTCAACTGGGCA TGAGTGTCCCATCTGCTTGA
IRAK1 GAGACCCTTGCTGGTCAGAG GCTACACCCACCCACAGAGT
GAPDH GGTGAAGGTCGGTGTGAACG TGTAGACCATGTAGTTGAGGTCA
  1. NALP3 NACHT, LRR and PYD domains-containing protein 3, ASC apoptosis-associated speck-like protein containing a CARD, TRAF6 TNF receptor associated factor 6, IRAK1 interleukin-1 receptor-associated kinase, GAPDH glyceraldehyde-3-phosphate dehydrogenase