Skip to main content

Table 1 ᅟ

From: Fcγ receptor-mediated influx of S100A8/A9-producing neutrophils as inducer of bone erosion during antigen-induced arthritis

Gene Primer sequences (5′-3′)
Gapdh Forward: GGCAAATTCAACGGCACA
Reverse: GTTAGTGGGGTCTCGCTCCTG
Nfatc1 Forward: ATGCGAGCCATCATCGA
Reverse: GGGATGTGAACTCGGAAGAC
Acp5 Forward: GACAAGAGGTTCCAGGAG ACC
Reverse: GGGCTGGGGAAGTTCCAG
Calcr Forward: CGTTCTTTATTACCTGGCTCTTGTG
Reverse: TCTGGCAGCTAAGGTTCTTGA AA
Mmp9 Forward: GGAACTCACACGACATCTTCCA
Reverse: GAAACTCACACGCCAGAAGAATTT
Ca2 Forward: GCTGCAGAGCTTCACTTGGT
Reverse: AAACAGCCAATCCATCCGGT
Oscar Forward: TGGTCATCAGTTTCGAAGGTTCT
Reverse: CAGCCCCAAACGGATGAG
Dcstamp Forward: TGTATCGGC TCATCTCCTCCAT
Reverse: GACTCCTTGGGTTCCTTGCTT
Clcn7 Forward: AGCCTGGACTATGACAACAGC
Reverse: GGAAAGCCGTGTGGTTGATT
Ctsk Forward: GAAGCAGTATAACAGCAAGGTGGAT
Reverse: TGTCTCCCAAGTGGTTCATGG