Skip to main content

Table 2 The sequences of quantitative polymerase chain reaction primers

From: Long noncoding RNA expression profile and association with SLEDAI score in monocyte-derived dendritic cells from patients with systematic lupus erythematosus

Primer name Sequence (5’ to 3’)
gapdh(Hs) forward TGACTTCAACAGCGACACCCA
gapdh(Hs) reverse CACCCTGTTGCTGTAGCCAAA
ENST00000604411.1 forward AGCCCCACTTCACATTAGACC
ENST00000604411.1 reverse TGATGTTGCAGTCCTGTGAGG
ENST00000501122.2 forward TTCTGCTTTCTGCCCATGTA
ENST00000501122.2 reverse GTGGCAGTGACAACCTCTCA
ENST00000568394.1 forward TCTCTCCCCAGTGACAGTACA
ENST00000568394.1 reverse GCGATCTGTAGTCCAGGTGT
lnc-HSFY2–3:3 forward TGATTGGAAGATGGAAGTGGA
lnc-HSFY2–3:3 reverse GCTCCACCTGAAACTCATTTG
lnc-SERPINB9–1:2 forward GGGGAAAATAAAAGGGATGGT
lnc-SERPINB9–1:2 reverse TCTCTCTTAGGGAAGGGCATT