Skip to main content

Table 1 Primers used for real-time polymerase chain reaction

From: E2F2 directly regulates the STAT1 and PI3K/AKT/NF-κB pathways to exacerbate the inflammatory phenotype in rheumatoid arthritis synovial fibroblasts and mouse embryonic fibroblasts

Primer name Primer base sequence (5’ to 3’)
GAPDH (homo) Forward: CACCATCT TCCAGGAGC;Reverse: AGTGGACTCCACGACGTA
GAPDH (mus) Forward: AAAGGGTCATCATCTCCG;Reverse: CAATCTTGAGTGAGTTGTCATATTTC
E2F2 (homo) Forward: CCTTGGA GGCTACTGACAGC;Reverse: CCACAGGTAGTCGTCCTGGT
E2F2 (mus) Forward: TGTTTCCCTGGGAGGATTATT;Reverse: TTTGGGACAGTGGGTGTTTA
STAT1 (homo) Forward: TACACCTACGAACATGACCC;Reverse: TGAAGGTGCGGTCCCATAA
STAT1 (mus) Forward: TGGGAAGTATTATTCCAGACCAAA;Reverse: AGTCTTGATGTATCCAGTTCG
MyD88 (homo) Forward: CTGGCCTCTGGCATATTC;Reverse: CTCCCTGCTCACATCATTAC
MyD88 (mus) Forward: TGCCAGCGAGCTAATTG;Reverse: CACATTCCTTGCTCTGTAGATA
AKT1 (homo) Forward: GGCGTGGTCATGTACGA;Reverse: TTCTCATGGTCCTGGTTGTAG
AKT1 (mus) Forward: GGACGGGCACATCAAGATAA;Reverse: CCGCAGAATGTCTTCATAG
AKT2 (homo) Forward: TACACCTACGAACATGACCC;Reverse: TGAAGGTGCGGTCCCATAA
AKT2 (mus) Forward: TTCAGAAGTGGACACAAGGT;Reverse: GGGTCCAGGCTGTCATATC
IL-1α (homo) Forward: CGTCAGGCAGAAGTTTGTCA;Reverse: TTAGAGTCGTCTCCTCCCGA
IL-1α (mus) Forward: ATCACAGGTAGTGAGACCGA;Reverse: AGCTGATGTGAAGTAGTTCTTAG
IL-1β (homo) Forward: CTAAAGTATGGGCTGGACTG;Reverse: AGCTTCAATGAAAGACCTCA
IL-1β (mus) Forward: CAAGGAGAACCAAGCAACGA;Reverse: TTTCATTACACAGGACAGGTATAGA
TNF-α (homo) Forward: TGTCTACTGAACTTCGGGGT;Reverse: TCACAGAGCAATGACTCCAA
TNF-α (mus) Forward: AGGTTCTCTTCAAGGGACAA;Reverse: GACTTTCTCCTGGTATGAGATAG
  1. IL interleukin, TNF tumor necrosis factor