Skip to main content

Table 1 Primer sequences used for TaqMan probe genotyping of BDNF

From: Association between brain-derived neurotrophic factor gene polymorphisms and fibromyalgia in a Korean population: a multicenter study

Regions Primers Primer sequence (5′ → 3′)
rs 2883187 Forward GTGAGGCATCCGGCCCGGCTGGGGA
Reverse CGGAGCGCGGTCTCGGCAGCTCCCC
rs 7103873 Forward AGGACCTTTTACCCCCAAATGTAGA
Reverse ACTAAATGAAAAACCATTCTTTAAA
rs 7103411 Forward GGAGCGCACTGTAAAGATACTGATA
Reverse GAACACGAATGTGAGATCAATGTTG
rs 10835210 Forward CTTAACTGTAAAGCACAGGAAAGTG
Reverse TCATTACTTGTAGCTTAATGCAGGA
rs 11030104 Forward ATTAAAAAGCAGATAACACTACCAC
Reverse TACTAACTGTCCTACAATTTCCTGT
rs 12273539 Forward ACTCAATGCTTCATCACTTCTGCTC
Reverse GATCAGGACAGAGTCCTTGGAGTGC
rs 11030102 Forward CTACTTCTCAGTTCTGAGGCATGGA
Reverse TTACAAAAAGACACATACATGCAAT
rs 11030101 Forward GATACTCTATTATAGCAAAGAAGAA
Reverse GATAATTTCATTGAGCCATCCTGTT
rs 6265 Forward TCCTCATCCAACAGCTCTTCTATCA
Reverse GTGTTCGAAAGTGTCAGCCAATGAT
rs 7124442 Forward AAGGAAGCTGCATAAAGTTGACATA
Reverse AGCAGATATTCCAAGCATTCCTTAC
  1. BDNF brain-derived neurotrophic factor