Skip to main content

Advertisement

Table 2 Primers used for RT-qPCR

From: Antibodies against specific extractable nuclear antigens (ENAs) as diagnostic and prognostic tools and inducers of a profibrotic phenotype in cultured human skin fibroblasts: are they functional?

  Cat. no. (Qiagen) Forward sequence Reverse sequence
Target gene
 ACTA2 QT00088102 CTATGCCTCTGGACGCACAACT CAGATCCAGACGCATGATGGCA
 COL1A1 QT00037793 GATTCCCTGGACCTAAAGGTGC AGCCTCTCCATCTTTGCCAGCA
 TAGLN QT00072247 TCCAGGTCTGGCTGAAGAATGG CTGCTCCATCTGCTTGAAGACC
Housekeeping gene
 GAPDH QT00079247 GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA