Skip to main content

Advertisement

Table 1 Primer list

From: Chondrogenic induction of human osteoarthritic cartilage-derived mesenchymal stem cells activates mineralization and hypertrophic and osteogenic gene expression through a mechanomiR

Genes Forward (5′–3′) Reverse (5′–3′)
18S CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT
SOX9 CCCCAACAGATCGCCTACAG GAGTTCTGGTCGGTGTAGTC
ACAN AGTCCTCAAGCCTCCTGTACTCA CGGGAAGTGGCGGTAACA
COL2A1 GCCTGGTGTCATGGGTTT GTCCCTTCTCACCAGCTTTG
RUNX2 GGCAGGCACAGTCTTCCC GGCCCAGTTCTGAAGCACC
IHH CCGCGTGGCAGCTGTCTCTAC CCCCATGCCAAGCTGTGAAAG
COL10A1 GCCCACAGGCATAAAAGGCCC GAAGGACCTGGGTGCCCTCGA
ADAMTS5 GGCCGTGGTGAAGGTGGTGG GCTGCGTGGAGGCCATCGTC
COL1A1 CAGGAGGCACGCGGAGTGTG GGCAGGGCTCGGGTTTCCAC
OCN AGGGCAGCGAGGTAGTGAAG ATAGGCCTCCTGAAAGCCG