Skip to main content

Advertisement

Table 2 Primer sequence

From: Long non-coding XIST raises methylation of TIMP-3 promoter to regulate collagen degradation in osteoarthritic chondrocytes after tibial plateau fracture

GenePrimer sequence (5′–3′)
TIMP-3-MF: TCGAGGATTTAGCGGTAAGTATC
R: GAAAACAAAAAATAACGAAACGAA
TIMP-3-UF: TTTTGAGGATTTAGTGGTAAGTATTG
R: CCAAAAACAAAAAATAACAAAACAA
  1. Notes: F forward, R reverse, M methylated, U unmethylated, TIMP-3 tissue inhibitor of metalloproteinase 3