Skip to main content

Table 1 Primer sequences for real-time PCR

From: Inhibition of Nrf2/HO-1 signaling leads to increased activation of the NLRP3 inflammasome in osteoarthritis

Gene name Primer sequence (5′ to 3′) Product (bp) GenBank serial number
Nrf2 Forward GGTTGCCCACATTCCCAAATC 119 NM_001313901.1
Reverse CAAGTGACTGAAACGTAGCCG
NLRP3 Forward AAAGGAAGTGGACTGCGAGA 129 XM_011544055.2
Reverse TTCAAACGACTCCCTGGAAC
HO-1 Forward TTCAAGCAGCTCTACCGCTC 90 NM_002133.2
Reverse GAACGCAGTCTTGGCCTCTT
IL-1β Forward CCACAGACCTTCCAGGAGAA 121 XM_017003988.1
Reverse GTGATCGTACAGGTGCATCG
IL-18 Forward TGCATCAACTTTGTGGCAAT 169 XM_011542806.2
Reverse ATAGAGGCCGATTTCCTTGG
GAPDH Forward GGACTCATGACCACAGTCCAT 109 NM_000194.2
Reverse CAGGGATGATGTTCTGGAGAG