Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences for real-time PCR

From: Inhibition of Nrf2/HO-1 signaling leads to increased activation of the NLRP3 inflammasome in osteoarthritis

Gene namePrimer sequence (5′ to 3′)Product (bp)GenBank serial number
Nrf2ForwardGGTTGCCCACATTCCCAAATC119NM_001313901.1
ReverseCAAGTGACTGAAACGTAGCCG
NLRP3ForwardAAAGGAAGTGGACTGCGAGA129XM_011544055.2
ReverseTTCAAACGACTCCCTGGAAC
HO-1ForwardTTCAAGCAGCTCTACCGCTC90NM_002133.2
ReverseGAACGCAGTCTTGGCCTCTT
IL-1βForwardCCACAGACCTTCCAGGAGAA121XM_017003988.1
ReverseGTGATCGTACAGGTGCATCG
IL-18ForwardTGCATCAACTTTGTGGCAAT169XM_011542806.2
ReverseATAGAGGCCGATTTCCTTGG
GAPDHForwardGGACTCATGACCACAGTCCAT109NM_000194.2
ReverseCAGGGATGATGTTCTGGAGAG