Skip to main content

Table 1 Primers used for PCR

From: The effect of nicotinamide adenine dinucleotide phosphate oxidase 4 on migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis

  Sense primer Antisense primer
NOX1 GTTTTACCGCTCCCAGCAGAA GGATGCCATTCCAGGAGAGAG
NOX2 CAAGATGCGTGGAAACTACCTAAGAT TCCCTGCTCCCACTAACATCA
NOX3 ACCGTGGAGGAGGCAATTAGACAA CAGGTTGAAGAAATGCGCCACGAT
NOX4 CTCAGCGGAATCAATCAGCTGTG AGAGGAACACGACAATCAGCCTTAG
NOX5 ATCAAGCGGCCCCCTTTTTTTCAC CTCATTGTCACACTCCTCGACAGC
DUOX1 TTCACGCAGCTCTGTGTCAA AGGGACAGATCATATCCTGGCT
p22phox(CYBA) CGCTGGCGTCCGCCTGATCCTCA ACGCACAGCCGCCAGTAGGTAGAT
p67phox(NCF2) ATCAGCCTCTGGAATGAAGGGG GCAGCCAATGTTGAAGCAAATCC
GAPDH CACATGGCCTCCAAGGAGTAA TGAGGGTCTCTCTCTTCCTCTTGT