Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Mesenchymal stem cell-derived exosomal microRNA-136-5p inhibits chondrocyte degeneration in traumatic osteoarthritis by targeting ELF3

  Forward (5′-3′) Reverse (5′-3′)
miR-136-5p TCCGCCCCTCTAGTCGTGT AAGGGAACAGGCGTGGACAG
ELF3 (human) TGAACCTGCACACTCCAGTC GGTTGCTCAGGGTCAGTACC
MMP-13 (human) GCCTTCAAAGTTTGGTCCGATG TGGTCAAGACCTAAGGAGTGGC
Collagen II (human) CAGGACCAAAGGGACAGAAAGG GCAGTTCACCAACCGTAGGAGT
Aggrecan (human) AGCTCTGGGGAGGAATCTGG GCAGTTCACCAACCGTAGGAGT
Sox9 GCTCTGGAGACTTCTGAACG GGGTGGTCCTTCTTGTGCT
β-actin (human) GATGTGGATCAGCAAGCAGG AAAACGCAGCTCAGTAACAGTC
RNU6B AACTCAAGACAATGGTGATAATGGT AAAGAACAGAAAGGAATACGCAGA
ELF3 (mice) CATCCTAATCCACCCCGAGC GGCCTCTGAGCGAAGAAACT
MMP-13 (mice) CTTCTTCTTGTTGAGCTGGACTC CTGTGGAGGTCACTGTAGACT
Collagen II (mice) CTGGTGGAGCAGCAAGAGCAA CAGTGGACAGTAGACGGAGGAAAG
Aggrecan (mice) CCTGCTACTTCATCGACCCC AGATGCTGTTGACTCGAACCT
β-actin (mice) CCTCTATGCCAACACAGT AGCCACCAATCCACACAG
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-136-5p microRNA-136-5p, ELF3 E74-like factor 3, MMP-13 matrix metalloproteinase 13, Sox9 136-KB DEL, upstream regulatory region