Skip to main content

Table 1 Selected genes and their mouse-specific primer sequences

From: The relationship between synovial inflammation, structural pathology, and pain in post-traumatic osteoarthritis: differential effect of stem cell and hyaluronan treatment

Gene nameAccession numberSequenceMelt (°C)Product size
GapdhNM_001289706.1F—TGCGACTTCAACAGCAACTC
R—CTTGCTCAGTGTCCTTGCTG
55200
Adamts4NM_172845.3F—TAACTTGAATGGGCAGGGGGGTTC
R—AATGGCTTGAGTCAGGACCGAAGG
60245
Adamts5NM_011782.2F—TCTCCAAAGGTTACGGATGGG
R—TCTTCTTCAGGGCTAAGTAGGCAG
55298
Mmp2NM_008610F—ATTTGGCGGACAGTGACACCAC
R—ATCTACTTGCTGGACATCAGGGGG
59231
Mmp3NM_010809.1F—GCTGAGGACTTTCCAGGTGTTG
R—GGTCACTTTTTTGGCATTTGGGTC
53120
Mmp9NM_013599F—TGGCTTTTGTGACAGGCACTTC
R—CGGTGGTGTTCTCCAATGTAAGAG
55223
Mmp13NM_008607F—GATGACCTGTCTGAGGAAG
R—ATCAGACCAGACCTTGAAG
55357
IL1bNM_008361.4F—ACCTGTTCTTTGAAGTTGACGGAC
R – TCTTGTTGATGTGCTGCTGCGAG
55117
IL6NM_031168.2F—CTTCCATCCAGTTGCCTTCTTG
R – TGTTGGGAGTGGTATCCTCTGTG
55104
Ccl3NM_011337F—GAAGGATACAAGCAGCAGCGAG
R—GAGAAGAACAGCAAGGGCAGTG
55115