Skip to main content

Table 2 Primer sequences used in this study

From: TGFβ-mediated expression of TGFβ-activating integrins in SSc monocytes: disturbed activation of latent TGFβ?

GeneForward primer 5′→3′Reverse primer 5′→3′
GAPDH*ATCTTCTTTTGCGTCGCCAGTTCCCCATGGTGTCTGAGC
HPRT*CCTGGCGTCGTGATTAGTGATCTCGAGCAAGACGTTCAGT
TBP*GCTTCGGAGAGTTCTGGGATTGGCAGCAAACCGCTTGGGATTA
RPS27A*TGGCTGTCCTGAAATATTATAAGGTCCCCAGCACCACATTCATCA
ITGA5ACTCAACTGCACCACCAATCACTCCGGGCATTTCAGGATCTG
ITGAVAGCGGGACCATCTCATCACTTGAGCAACTCCACAACCCAAA
ITGB1TGGTGTGGTTGCTGGAATTGTTTTCACCCGTGTCCCATTTG
ITGB3CCGGCCAGATGATTCGAAGATGCTCCACAGATCATCCTTCA
ITGB5TGGGGAGATGTGTGAGAAGTGGCACTCGACGCAATCTCTCT
ITGB6CTGGTGTGCTCAGGAGAATTTCTTGGGAGACAGGGTTTTCGA
ITGB8TTGCTGCTGGTGATGACAGATGGTGTTCCATGGTTGTCGATTT
  1. *Reference genes
\