Skip to main content

Table 1 Primers used for MIF qPCR

From: Macrophage migration inhibitory factor may play a protective role in osteoarthritis

Gene Primer sequence (5′ > 3′) Amplicon Size (bp) Efficiency R2
GAPDH Forward: GCAAATTCCATGGCACCGT 106 102% 0.999
Reverse: TCGCCCCACTTGATTTTGG
MIF Forward: CCCGGACAGGGTCTACATCAACTA 64 96% 0.996
Reverse: GGAGTTGTTCCAGCCCACAT
  1. qPCR quantitative polymerase chain reaction, GAPDH glyceraldehyde-3-phosphate dehydrogenase, MIF macrophage migration inhibitory factor