Skip to main content

Table 1 Primers used for gene expression analysis

From: Stimulation of regulatory T cells with Lactococcus lactis expressing enterotoxigenic E. coli colonization factor antigen 1 retains salivary flow in a genetic model of Sjögren’s syndrome

Gene name Primer Sequence (5`➔3`) Amplicon size Source
Foxp3 F
R
AGCCATGATCAGCCTCCCAC
GGGTAGGATCCTTGGGGTG
136 In this study
Tgfβ F
R
CTTCAATACGTCAGACATTCGG
GTAACGCCAGGAATTGTTGCTA
142 [55]
Il10 F
R
GCTCTTACTGACTGGCATGAG
CGCAGCTCTAGGAGCATGTG
105 [56]
Rorγt F
R
GACCACACCTCACAAATTGA
AGTAGGCCACATTACACTGCT
166 In this study
Il17 F
R
GACTCCTGGGAAGACCTCATT
GAGGACCTTTTGGGATTGGTA
189 In this study
Tbet F
R
AGCAAGGACGGCGAATGTT
GTGGACATATAAGCGGTTCC
175 [57]
Ifnγ F
R
ATGAACGCTACACACTGCATC
CCATCCTTTTGCCAGTTCCTC
152 [58]
Tnfα F
R
CCCTCACACTCAGATCATCTTCT
GCTACGACGTGGGCTACAG
228 [56]
βactin F
R
ATCTACGAGGGCTATGCTCTCC
AGCCTCGGTCAGGATCTTCAT
96 [59]