Skip to main content

Table 1 Sequences of primers used for RT-PCR

From: Denosumab alleviates intervertebral disc degeneration adjacent to lumbar fusion by inhibiting endplate osteochondral remodeling and vertebral osteoporosis in ovariectomized rats

Gene Forward primer (5′-3′) Reverse primers (5′-3′)
GAPDH GGGGAGCCAAAAGGGTCATCATCT GAGGGGCCATCCACAGTCTTCT
Aggrecan GAAGTGGCGTCCAAACCAAC AGCTGGTAATTGCAGGGGAC
ADAMTS-4 CGTTCCGCTCCTGTAACACT TTGAAGAGGTCGGTTCGGTG
MMP-13 TGCTGCATACGAGCATCCAT TTCCCCGTGTCCTCAAAGTG