Skip to main content

Table 1 Genes, accession numbers, primer sequences, and amplicon sizes for qRT-PCR

From: Hyaluronic acid synthesis, degradation, and crosslinking in equine osteoarthritis: TNF-α-TSG-6-mediated HC-HA formation

Genes Accession number Primer sequences Amplicon size (bp)
HAS1 XM_023650323.1 For: GCGATACTGGGTGGCCTTCAATGT
Rev: CTGTATAGGCCTAGGGGACCACTG
90
HAS2 NM_001081801.2 For: GGCCGGTCGTCTCAAATTCA
Rev: TCACAATGCATCTTGTTCAGCTC
132
HAS3 XM_023637194.1 For: CGTGGGCGCATCTGGAACATT
Rev: CTCTGCATTGCCCCGAAGGAAG
99
TSG6 NM_001081906.1 For: ATCCTGAGCAGCCCCTAACA
Rev: TTGAATCCCCATCCGTGAGC
108
HYAL2 XM_014731656.1 For: CTCACAGGGCTTAGCGAGAT
Rev: GGTACTGGCAGGTCTCCGTG
124
HEXA XM_001494311.4 For: AAGGAGCTGGAACTGGTCAC
Rev: TCAGGGGTACCGTCAAATGC
137
18S rRNA NR_046271.1 For: GGCGTCCCCCAACTTCTT
Rev: AGGGCATCACAGACCTGTTATTG
77