Skip to main content

Table 3 siRNA oligos against WNT16

From: WNT16 elevation induced cell senescence of osteoblasts in ankylosing spondylitis

siRNA Sequence (5′-3′)
Negative control Sense CCUCGUGCCGUUCCAUCAGGUAGUU
Antisense CUACCUGAUGGAACGGCACGAGGUU
WNT16 #1 Sense CCAAGUUGAUGUCAGUAGAUU
Antisense UCUACUGACAUCAACUUGGUU
WNT16 #2 Sense GGAUGAUCUGCUCUAUGUUUU
Antisense AACAUAGAGCAGAUCAUCCUU
WNT16 #3 Sense CCAACUACUGUGUAGAAGAUU
Antisense UCUUCUACACAGUAGUUGGUU
WNT16 #4 Sense CUGAUCAACCCAUCAAUCAUU
Antisense UGAUUGAUGGGUUGAUCAGUU
WNT16 #5 Sense CUGACUUACCCUUUCAUGUUU
Antisense ACAUGAAAGGGUAAGUCAGUU