Skip to main content

Table 1 Primer sequences for several factors involved in bone regulation and for β-actin

From: Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis

Gene name Genebank accession number Sequence position Primers Sequence
β-Actin NM007393 694–831 Bactin.for
Bactin.rev
5'-AGAGGGAAATCGTGCGTGAC-3'
5'-CAATAGTGATGACCTGGCCGT-3'
IL-11 NM008350 350–450 IL-11.for
IL-11.rev
5'-TGATGTCCTACCTCCGGCAT-3'
5'-TTCCAGTCGGGCTTGCAG-3'
IL-17 NM010552 146–246 IL-17.for
IL-17.rev
5'-CCTCAAAGCTCAGCGTGTCC-3'
5'-GAGCTCACTTTTGCGCCAAG-3'
COX-2 NM011198 854–954 COX-2.for
COX-2.rev
5'-GGTGGAGAGGTGTATCCCCC-3'
5'-ACTTCCTGCCCCACAGCA-3'
iNOS NM010927 872–972 iNOS.for
iNOS.rev
5'-AACAATGGCAACATCAGGTCG-3'
5'-CCAGCGTACCGGATGAGCT-3'
OPG U94331 831–931 OPG.for
OPG.rev
5'-AGAGCAAACCTTCCAGCTGC-3'
5'-CGCTGCTTTCACAGAGGTCA-3'
RANK AF19046 1422–1440 RANK.for
RANK.rev
5'-TGCCTACAGCATGGGCTTT-3'
5'AGAGATGAACGTGGAGTTACTGTTT3'
RANKL AF53713 606–680 RANKL.for
RANKL.rev
5'-TGGAAGGCTCATGGTTGGAT-3'
5'-CATTGATGGTGAGGTGTGCAA-3'
  1. COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; OPG, osteoprotegerin; RANK, receptor activator of nuclear factor-κB; RANKL, receptor activator of nuclear factor-κB ligand.