Skip to main content

Table 1 Primers used in the present study

From: Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture

Primer Sequence
β-actin Forward 5'-3' AAGCCACCCCACTTCT-CTCTAA
  Reverse 5'-3' AATGCTATCACCTCCCCTGTGT
COL1A2 Forward 5'-3'TTGCCCAAAGTT-GTCCTCTTCT
  Reverse 5'-3' AGCTTCTGTGGAACCATGGAA
COL2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCT
  Reverse 5'-3' GGGCATTTGACTCACACCAGT
HIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGT
  Reverse 5'-3' CTTGTTTACAGTCTGCTCA-AAATATCTT
P4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATT
  Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG,
P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA
  Reverse 5'-3' TTTGGTTCACTGAAACA-TCTCACA
P4Hα(III) Forward 5'-3' CTCAACAGTCTCAGGTTCGATCA
  Reverse 5'-3' TTCTTGGTCCCTGTGGTCAAG
PHD2 Forward 5'-3'TGGCC-TATATGTGTTTAATCCTGGTT
  Reverse 5'-3'TGTTTTACAGCTGGTTAATGTG-TTGA
SOX9 Forward 5'-3'CTTTGGTTTGTGTTCGTGTTTTG
  Reverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT
  1. COL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX, Sry-related HMG box-9.