Skip to main content

Advertisement

Table 1 Sequences of primers used to quantify gene expression by real-time PCR

From: Glucosamine affects intracellular signalling through inhibition of mitogen-activated protein kinase phosphorylation in human chondrocytes

Gene Primers GenBank
GAPDH Forward: GGAGTCAACGGATTTGGTCGTA NM_002046
  Reverse: GGCAACAATATCCACTTTACCAGAGT  
MMP-1 Forward: GATGGACCTGGAGGAAATCTTG NM_002421
  Reverse: TGAGCATCCCCTCCAATACC  
MMP-2 Forward: GCACCCATTTACACCTACACCAA NM_004530
  Reverse: AGAGCTCCTGAATGCCCTTGA  
MMP-3 Forward: CCTGGTACCCACGGAACCT NM_002422
  Reverse: AGGACAAAGCAGGATCACAGTTG  
MMP-8 Forward: GACCAACACCTCCGCAAATT NM_002424
  Reverse: CCCCAAAGAATGGCCAAAT  
MMP-9 Forward: GGACGATGCCTGCAACGT NM_004994
  Reverse: ACAAATACAGCTGGTTCCCAATC  
MMP-13 Forward: TTCTTGTTGCTGCGCATGA NM_002427
  Reverse: TGCTCCAGGGTCCTTGGA  
  1. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix metalloprotease.