Skip to main content

Advertisement

Table 1 Primer oligonucleotide sequences used for real-time PCR

From: Chondrogenic differentiation potential of osteoarthritic chondrocytes and their possible use in matrix-associated autologous chondrocyte transplantation

Gene Forward primer 5'-3' Reverse primer 5'-3' Accession number
COL1A1 CGATGGCTGCACGAGTCACAC CAGGTTGGGATGGAGGGAGTTTAC [GenBank:NM_000088]
COL10A1 GAACTCCCAGCACGCAGAATCC GTGTTGGGTAGTGGGCCTTTTATG [GenBank:NM_000493]
COL2A1 CCGGGCAGAGGGCAATAGCAGGTT CATTGATGGGGAGGCGTGAG [GenBank:NM_001844]
COMP GGGTGGCCGCCTGGGGGTCTT CTTGCCGCACGCTGATGGGTCTC [GenBank:NM_000095]
CRTL1 GCGTCCGCTACCCCATCTCTA GCGCTCTAAGGGCACATTCAGTT [GenBank:NM_001884]
GAPDH GGCGATGCTGGCGCTGAGTAC TGGTTCACACCCATGACGA [GenBank:NM_000095]
MMP1 TACATGCGCACAAATCCCTTCTACC GAAAAACCGGACTTCATCTCTGTCG [GenBank:NM_002421]
MMP13 CAAAAACGCCAGACAAATGTGACC GATGCAGGCGCCAGAAGAATCT [GenBank:NM_002427]
SOX9 CTGAGTCATTTGCAGTGTTTTCT CATGCTTGCATTGTTTTTGTGT [GenBank:NM_000346]
TIMP4 TTTCTTCTGGCTTAGTCTGTTTTCT ATTCGCCATTTCTCCCCTACCA [GenBank:NM_003256]