Skip to main content

Advertisement

Table 1 Bovine oligonucleotide primers

From: Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes

Gene name Gene symbol NCBI ref. seq. Forward primer Reverse primer
Glyceraldehyde-3-phosphate dehydrogenase GAPDH NM_001034034.1 TGCCGCCTGGAGAAACC CGCCTGCTTCACCACCTT
Aggrecan ACAN NM_173981.2 GGGAGGAGACGACTGCAATC CCCATTCCGTCTTGTTTTCTG
Versican VCAN NM_181035.2 GCTGCATGCCGCCTATG TCCGTAGGTCCGGACTCCTT
Collagen, type II, alpha 1 COL2A1 NM_001001135.2 CGGGCTGAGGGCAACA CGTGCAGCCATCCTTCAGA
Synaptosomal associated protein 25 SNAP25 NM_001076246.1 GGCTTCATCCGCAGGGTAA GCTCCAGGTTTTCATCCATTTC
Keratin 8 KRT8 NM_001033610.1 ACCAGGAGCTCATGAATGTCAA TCGCCCTCCAGCAGCTT
Keratin 18 KRT18 XM_582930.4 TTGAGCTGCTCCATCTGCAT AAGGCCAGCTTGGAGAACAG
Keratin 19 KRT19 XM_875997.3 CGGTGCCACCATTGAGAACT CAAACTTGGTGCGGAAGTCA
N-Cadherin CDH2 XM_001250829.2 GCCATCAAGCCAGTTGGAA TGCAGATCGAACCGGGTACT
Sclerostin domain containing 1 SOSTDC1 NM_001046265.1 GTTCAAGTAGGCTGCCGAGAA GCACTGGCCGTCTGAGATG
Integrin-binding sialoprotein IBSP NM_174084.2 GACAGCTATGATGGTCAAGATTACTACA TGGGTGAACTCATCCCAGTCT
Tenomodulin TNMD NM_001099948.1 TCTGGCGTGACGGGTCTT AAAAAAGGCATTGAACAAAACGA
Brain attached signalling protein 1 BASP1 NM_174780.3 TTGTGGATGAATGCCAACTTTC AAAAATGGAGTATTGGCATCAAGAT
TNF, alpha-induced protein 6 TNFAIP6 NM_001007813.1 AAGCAGCAGGCGTCTACCA CACACCGCCTTCGCTTCT
Forkhead box F1 FOXF1 XM_603148.4 TCCCTCCCCACCTCAGAAGT TGGCTTCAGAAATGCAAGTTACTC
Forkhead box F2 FOXF2 CK941878.1 TGCGTGGTAAGTTTTCACCATCT CCCCCGGTGAGGTAATGC
Aquaporin 1 AQP1 NM_174702.3 ACCAGGAGGCCCTTAATGGT CTGTTAAATGGACTAGAAGCGAAATG
Fibulin 1 FBLN1 NM_001098029.1 GCAGCGCAGCCAAGTCAT AGATATGTCTGGGTGCTACAAACG
T, brachyury homolog (mouse) T XM_864890.2 ACTTCGTGGCGGCTGACA GCACCCACTCCCCATTCA
  1. Bovine oligonucleotide primers used for quantitative real-time polymerase chain reaction (qRT-PCR).