Skip to main content

Table 1 PCR primers and conditions

From: Early response genes induced in chondrocytes stimulated with the inflammatory cytokine interleukin-1beta

    Annealing   Product
Gene Primers   temperature Cycles length*
MMP-13 CCAGTGGTGGTGATGAAGATG Sense 52°C 25 143
  TTCTCGGAGCCTCTCAGTC Antisense    
c-Jun GGAAACGACCTTCTATGACGATGCCCTCAA Sense 63°C 22 316
  GAACCCCTCCTGCTCATCTGTCACGTTCTT Antisense    
JunD GAGTGTTCGATTCTGCCCTA Sense 53°C 22 214
  TGTGGACTCGTAGCAAAACA Antisense    
JunB CCAGTCCTTCCACCTCGACGTTTACAAG Sense 58°C 22 257
  GACTAAGTGCGTGTTTCTTTTCCACAGTAC Antisense    
egr-1 TCCCGGCTCCTCGACCTAC Sense 60°C 25 177
  AAGGTTGCTGTCATGTCCGAAAG Antisense    
  1. GAPDH was amplified using Clontech's human GPDH amplimer set with an annealing temperature of 58°C and 25 cycles of amplification. MMP-13 = matrix metalloproteinase-13; egr-1 = early growth response gene-1. *Measured in base pairs.