Skip to main content

Table 2 Primer sequence used in quantitative PCR

From: Intensity-dependent effect of treadmill running on lubricin metabolism of rat articular cartilage

Primer Forward Reverse
GAPDH 5'-GGCACAGTCAAGGCTGAGAATG -3' 5'-ATGGTGGTGAAGACGCCAGTA-3'
PRG4 5'- AGGGCGTTGCATCCAAGAA -3' 5'-ACAGTTGCAGGTGGCGTCTCTA-3'
TGF-β1 5'- TGCGCCTGCAGAGATTCAAG -3' 5'- TAACGCCAGGAATTGTTGCTA-3'
  1. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PRG4, proteoglycan; TGF-β1, transforming growth factor- β1.