Skip to main content

Table 1 Gene primers for quantitative PCR analysis

From: IL-29 enhances Toll-like receptor-mediated IL-6 and IL-8 production by the synovial fibroblasts from rheumatoid arthritis patients

Gene name Forward (5′ to 3′) Reverse (5′ to 3′)
Human IL-29 GAAGCAGTTGCGATTTAGCC GAAGCTCGCTAGCTCCTGTG
Human IL-6 AACCTGAACCTTCCAAAGATGG TCTGGCTTGTTCCTCACTACT
Human IL-8 CATACTCCAAACCTTTCCACCCC TCAGCCCTCTTCAAAAACTTCTCCA
Human TLR2 TGTTGCAAGCAGGATCCAAAG CACAAAGTATGTGGCATTGTCCAG
Human TLR3 GGACTTTGAGGCGGGTGTT TGTTGAACTGCATGATGTAC CTTGA
Human TLR4 AGGATGATGCCAGCATGATGTC TCAGGTCCAGGTTCTTGGTTGAG
Human GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC