Skip to main content

Table 2 Quantitative PCR primer list a

From: Novel immortal human cell lines reveal subpopulations in the nucleus pulposus

Symbol Gene name Tissue Forward primer Reverse primer
ACAN Aggrecan AC, NP GCAGCTGGGCGTTGTCA TGAGTACAGGAGGCTTGAGGACT
CA12 Carbonic anhydrase XII NP ATCCAACTAATGCCACCACCAA TGAGACCACGAAGAGACTGGCT
COL1A1 Collagen type I, collagen α1 AF TGGAGAGTACTGGATTGACCCC TGCAGAAGACTTTGATGGCATC
COL2A1 Collagen type II, collagen α1 AC, NP TGGGTGTTCTATTTATTTATTGTCTTCCT GCGTTGGACTCACACCAGTTAGT
COMP Cartilage oligomeric matrix protein AC CAAGGCCAACAAGCAGGTTTG CAGTTATGTTGCCCGGTCTCA
CD24 Cluster of differentiation 24 NP CCACGCAGATTTATTCCAGTGA GCCAACCCAGAGTTGGAAGTAC
FOXF1 Forkhead box F1 NP CCCACACAGGAATTCTGCTGA TTCCCCCACTTCTGCCATT
KRT19 Keratin 19 NC, NP GCAGTCACAGCTGAGCATGAA TCCGTTTCTGCCAGTGTGTCT
PAX1 Paired box 1 NP AGAGCCTGACATCGCCTGTTAA CGCTTTCCTTTATTCAGAGGCA
PTN Pleiotrophin NP AGAAGCAATTTGGCGCGGA TTCAGGTCACATTCTCCCCAGG
SOX9 SRY-box 9 AC, NP AGTACCCGCACCTGCACAAC CGCTTCTCGCTCTCGTTCAG
T Brachyury T NC CCACCTGCAAATCCTCATCCT TTGGAGAATTGTTCCGATGAGC
  1. aAC, Articular cartilage; AF: Annulus fibrosus; NC, Notochordal cell; NP, Nucleus pulposus. The sequences are the validated real-time primer sets used for the indicated genes that were subjected to quantitative PCR analysis. ‘Tissue’ column lists tissue in which marker expression is reported.