Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 RT-PCR and qRT-PCR primers

From: Histone deacetylase inhibition activates Nrf2 and protects against osteoarthritis

Genes RT-PCR primers
MMP-1 Forward: GTCAGGGGAGATCATCGG
MMP-1 Reverse: GCCCAGTACTTATTCCCT
MMP-3 Forward: ATGCCCACTTTGATGATGATGAAC
MMP-3 Reverse: CCACGCCTGAAGGAAGAGATG
MMP-13 Forward: GCTTAGAGGTGACTGGCAA
MMP-13 Reverse: CCGGTGTAGGTGTAGATAGGAA
GAPDH Forward: CTGCCGTCTAGAAAAACC
GAPDH Reverse: CCAAATTCGTTGTCATACC
Nrf2GT Forward: TGGACGGGACTATTGAAGGCTG
Nrf2-WT Reverse: CGCCTTTTCAGTAGATGGAGG
Nrf2-KO Reverse: GCGGATTGACCGTAATGGGATAGG
Genes qRT-PCR primers
IL-1β Forward: ATGGCAGAAGTACCTAAGCTCGC
IL-1β Reverse: ACACAAATTGCATGGTGAAGTCAGTT
TNF-α Forward: ATGAGCACAGAAAGCATGATCCGC
TNF-α Reverse: CCAAAGTAGACCTGCCCGGACTC
IL-6 Forward: ACACACTGGTTCTGAGGGAC
IL-6 Reverse: TACCACAAGGTTGGCAGGTG
MMP-1 Forward: GCCACAAAGTTGATGCAGTT
MMP-1 Reverse: GCAGTTGAACCAGCTATTAG
MMP-3 Forward: ATGAAAATGAAGGGTCTTCCGG
MMP-3 Reverse: GCAGAAGCTCCATACCAGCA
MMP-13 Forward: ATGCATTCAGCTATCCTGGCCA
MMP-13 Reverse: AAGATTGCATTTCTCGGAGCCTG
NQO1 Forward: TTTAGGGTCGTCTTGGCA
NQO1 Reverse: GTCTTCTCTGAATGGGCCAG
HO-1 Forward: ACATCGACAGCCCCACCAAGTTCAA
HO-1 Reverse: CTGACGAAGTGACGCCATCTGTGAG
β-actin Forward: TGACGGGGTCACCCACACTGTGCCCATCTA
β-actin Reverse: CTAGAAGCATTTGCGGTGGACGATGGAGGG
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, HO-1 heme oxygenase 1, IL interleukin, MMP matrix metalloproteinase, NQO1 NAD(P)H:quinine oxidoreductase 1, Nrf2 nuclear factor (erythroid-derived 2)-like 2; Nrf2-KO Nrf2-knockout, qRT-PCR quantitative real-time polymerase chain reaction, RT-PCR reverse transcription polymerase chain reaction, TNF tumor necrosis factor, WT wild type