Skip to main content

Table 2 Primer sequences for the genes measured in this experiment

From: Hedgehog signalling does not stimulate cartilage catabolism and is inhibited by Interleukin-1β

Gene Species Sequence (5′-3′)
Patched 1 Bovine F-ATGTCTCGCACATCAACTGG
R-TCGTGGTAAAGGAAAGCACC
Gli1 Bovine F-ACCCCACCACCAGTCAGTAG
R-TGTCCGACAGAGGTGAGATG
ADAMTS-5 Bovine F- GCCCTGCCCAGCTAACGGTA
R- CCCCCGGACACACACGGAA
MMP-13 Bovine F- CCCTTGATGCCATAACCAGT
R- GCCCAAAATTTTCTGCCTCT
18S rRNA Bovine F- GCAATTATTCCCCATGAACG
R- GGCCTCACTAAACCATCCAA
ADAMTS-5 Human F- CCTTGTGGAAAGGGGAGAAT
R- ACAGTGACGATAGGCAAACT
MMP-13 Human F- AGCCACTTTATGCTTCCTGA
R- TCAAACTGTATGGGTCCGTT
18S rRNA Human F- CGGCTACCACATCCAAGGAA
R- AGCTGGAATTACCGCGGC
  1. ADAMTS-5 a disintegrin and MMP with thrombospondin motifs-5, MMP-13 matrix metalloproteinase-13, 18S rRNA 18S ribosomal RNA