Skip to main content

Table 2 Primers for real-time PCR

From: CCN family member 2/connective tissue growth factor (CCN2/CTGF) is regulated by Wnt–β-catenin signaling in nucleus pulposus cells

Target NCBI number Forward primer, 5′- 3’ Reverse primer, 5′- 3’
CCN1 (CYR61) NM_031327.2 TCACTGAAGAGGCTTCCTGTC CCAGTTCCGCAGCTCTTG
CCN2 (CTGF) NM_022266.2 GCTGACCTAGAGGAAAACATTAAGA CCGGTAGGTCTTCACACTGG
CCN3 (NOV) NM_030868.2 CGGCCTTGTGAGCAAGAG TTCTTGGTCCGGAGACACTT
CCN4 (Wisp1) NM_031716.1 ACATCCGACCACACATCAAG AAGTTCGTGGCCTCCTCTG
CCN5 (Wisp2) NM_031590.1 CAGGGCCTGGTTTGTCAG CCGTCATCCTCATCCAAGA
CCN6 (Wisp3) NM_001170483.1 CATGGAAGGCAGGGAAGA CTTTGGGGAGTTGGAAAGTG