Skip to main content

Table 1 Sequences of primers used for quantitative real-time PCR

From: Long non-coding RNA HOTAIR modulates intervertebral disc degenerative changes via Wnt/β-catenin pathway

Gene Forward (5–3′) Reverse (5–3′)
HOTAIR CATTCTGCCCTGATTTCCG ATCCGTTCCATTCCACTGCG
MMP3 TTCCTTGGATTGGAGGTGAC AGCCTGGAGAATGTGAGTGG
MMP9 CAGTCCACCCTTGTGCTCTTCCCTG ATCTCTGCCACCCGAGTGTAACCA
MMP10 CAGGTTATCCAAGAGGCATCCATAC TTAGGCTCAACTCCTGGAAAGTCAT
Type II collagen TCCAGATGACCTTCCTACGC GGTATGTTTCGTGCAGCCAT
Aggrecan TGAGCGGCAGCACTTTGAC TGAGTACAGGAGGCTTGAGG
Wnt1 GAATCGCCGCTGGAACTGTC GCGGAGGTGATAGCGAAGATAAACG
β-catenin CAAGTGGGTGGTATAGAGG AGTCCATAGTGAAGGCGAAC
GAPDH TCAAGAAGGTGGTGAAGCAGG TCAAAGGTGGAGGAGTGGGT