Skip to main content

Table 1 Primer sequences for related genes

From: JAG2/Notch2 inhibits intervertebral disc degeneration by modulating cell proliferation, apoptosis, and extracellular matrix

Gene Primer Sequences (5′–3′)
Rat NOTCH1 Forward: ACGCCTACCTCTGCTTCTGC
Reverse: CAGGCACACTCGTAGCCATC
Rat NOTCH2 Forward: ATGTGTCAACGGCTGGAGTG
Reverse: GCAAGAGAAGGAGGCCACAC
Rat NOTCH3 Forward: GCGAGGCAGACATCAATGAG
Reverse: ACAGCGAGGACCTGAGAAGC
Rat NOTCH4 Forward: GAAGGCCACAGACACAGCAG
Reverse: CACATGACCACTCCGTCCTC
Rat JAG1 Forward: CTGTGGCTTGGATCTGTTGC
Reverse: CGTTGTTGGTGGTGTTGTCC
Rat JAG2 Forward: ATCTGTGAGGACCTGGTGGATGG
Reverse: GTAGCAGCGAGCACCGTTGAG
Rat delta-like1 Forward: AGCCTCCGCCTGATCCTTGC
Reverse: TCCGCCTTCTTGTTGGTGTTCTTG
Rat delta-like 3 Forward: CTGCCTTGTCGTTGCCTGATGG
Reverse: GCCACACGCGCTAATAGGTTCC
Rat delta-like 4 Forward: AAGCATTACCAGGCAACCTTCTCC
Reverse: TTACGACCACTGCCGCTATTCTTG
Rat Hes1 Forward: CCAAGCTGGAGAAGGCAGACATTC
Reverse: GGTCACCTCGTTCATGCACTCG
Rat Hes5 Forward: GACCGCATCAACAGCAGCATTG
Reverse: TCTCCAGGATGTCGGCCTTCTC
Rat Hey1 Forward: CTGTCGCCGCCATGCTTCTC
Reverse: GCTGCCTGTGAGGTGTCAAGAC
Rat Hey2 Forward: CTAGAGAGGACCTGGAGAGTTTAAG
Reverse: CTGTGCCACCAGCCTTAAAACC
Rat CBF1 Forward: GGTGTGAGGAGGAGGAACAATGAC
Reverse: GCACGAGCAGCCATCTCAGC
Rat cyclin D1 Forward: CCTGACACCAATCTCCTCAACGAC
Reverse: TTCCGCATGGATGGCACAATCTC
Rat CDK6 Forward: CTCTGAAGCGCGTGCGAGTG
Reverse: AAGGTCTCCAGGTGCCTCAGC
Rat p21 Forward: GTTCCTTGTGGAGCCGGAGC
Reverse: GGTACAAGACAGTAGCAGATC
Rat PARP Forward: CTAAGTGTTCGTCTTTAG
Reverse: AGAAATTGTTAGCGTTCC
Rat PI3K Forward: CAATGATGCTTGGCTCTGGAATGC
Reverse: TTGTCCAGCCACCATGATGTGC
Rat Fas Forward: GGCGGGTTCGTGAAACTGAT
Reverse: AGGTTGGCATGGTTGACAGC
Rat RIP Forward: AGCCTGGTTCACTGCACAGTTC
Reverse: ATGGTAGTTGGCTTCGTCTTGGAG
Rat β-tubulin Forward: CAGCGATGAGCACGGCATAGAC
Reverse: CCAGGTTCCAAGTCCACCAGAATG
Rat β-actin Forward: CGTCCGTGACATCAAGGAGAAGC
Reverse: ACCGAGGAAGGAAGGCTGGAAG