Skip to main content

Table 1 The sequences of primers

From: Hsa_circ_0123190 acts as a competitive endogenous RNA to regulate APLNR expression by sponging hsa-miR-483-3p in lupus nephritis

Gene Forward primer sequence Reverse primer sequence
hsa_circ_0123190 TGAGGATGGAGAACCCACCAA CCCCCATCACATGAGCACAA
hsa_circ_0000660 TGCTTCCAGTGGGAATCCACAT TCAGAGAGCCGTAGGTTGCGTAT
hsa_circ_0007379 TCTCTTTCTCCAAGGAGCTCCACA TGCTGATGAAGCTGAGCAGGGA
hsa_circ_0003302 TGGATGTTCCACAGGAAGAAGTGC GGGCCACGGCGATAAGGAAAAT
APLNR AGGCAGCAGGGCTGATGAATGG TGCAGACACCCCTCCATCCTCT
hsa-miR-483-3p TCACTCCTCTCCTCCCGTCTT