Skip to main content

Table 1 Sequences of primers used in the real-time polymerase chain reaction

From: Lymphatic muscle cells contribute to dysfunction of the synovial lymphatic system in inflammatory arthritis in mice

Genes Sequences of primers GenBank accession number Annealing Tm(°C) Product size (bp)
SM α2-actin F: 5′ TATTCTGTCTGGATCGGCGG 3′
R: 5′ ACATTCACAGTTGTGTGCTAGAG 3′
NM_031004.2 60 196
SM α1-actin F: 5′ CATGGACCATTATGATTCCCAGC 3′
R: 5′ CTTTGCGCAGGTGGGAGTTG 3′
NM_031005.3 57 143
SM α22-actin F: 5′ TCTCCTTCCAGCCCACAAAC3′
R: 5′ TTCACGGCTCATGCCATAGG3′
NM_031549.2 60 82
h1-calponin F: 5′ TGGCCCAGAAATACGACCAC3′
R: 5′ CCGGCTGGAGCTTGTTGATA3′
NM_031747.1 60 144
Nfkb2 F: 5′ TCTGGTCACCAAGCTCCATGCTAA 3′
R: 5′ TGGATGTCAGCACCAGCCTTTAGA 3′
NM_001008349.1 60 129
Smooth muscle myosin, heavy chain 11 F: 5′ TCCGGTGTTCTCCTGCTAGT 3′
R: 5′ GGGCCATTGGGCTGTTTATG 3′
NM_001170600.1 60 134
β-Actin F: 5′ TTGCTGACAGGATGCAGAAGGAGA 3′
R: 5′ ACTCCTGCTTGCTGATCCACATCT 3′
NM_031144.3 60 159