Skip to main content

Table 2 RT-qPCR primers

From: WNT16 elevation induced cell senescence of osteoblasts in ankylosing spondylitis

Gene 5′-Forward-3′ 3′-Reverse-5′
GAPDH CAAGATCATCAGCAATGCC CTGTGGTCATGAGTCCTTCC
WNT16 CTACGGAGCCCAAGGAAACT CTCTCGTGTCTGAACTGGCT
TP53 ACCTATGGAAACTACTTCCTGAAA CTGGCATTCTGGGAGCTTCA
CDKN1A (p21) GCAGAGGAAGACCATGTGGA CGGCGTTTGGAGTGGTAGAA
CASP3 TCATTATTCAGGCCTGCCGT GTCGGCCTCCACTGGTATTT
IL1A TGGTAGTAGCAACCAACGGG GGTGCTGACCTAGGCTTGAT
IL1B CAGAAGTACCTGAGCTCGCC AGATTCGTAGCTGGATGCCG
IL6 ATGAACTCCTTCTCCACAAGCG CTCCTTTCTCAGGGCTGAG
IL8 TTCTGCAGCTCTGTGTGAAGG TAATTTCTGTGTTGGCGCAGTG