Skip to main content

Table 1 Primer sequences used to quantify gene expression

From: SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis

Gene Forward (5'-3') Reverse (5'-3')
GAPDH CACTCAGACCCCCACCACAC GATACATGACAAGGTGCGGCT
COMP CTGGGCCAACCTGCGTTA CGCAGCTGATGGGTCTCATAG
APOD ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT
S100A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT
RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG
SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA
SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA
CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT
CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA
MYBPH AGGCCTACAGTCAAACTCCAGAGA GAAGGGAGGCCAGCAGGTA