Skip to main content

Table 2 Primers used for real-time RT-PCR

From: Preserved skeletal muscle protein anabolic response to acute exercise and protein intake in well-treated rheumatoid arthritis patients

Target Sense primer Antisense primer
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTG
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT
IGF-IEa GACATGCCCAAGACCCAGAAGGA CGGTGGCATGTCACTCTTCACTC
IGF-IEc GCCCCCATCTACCAACAAGAACAC CGGTGGCATGTCACTCTTCACTC
HGF TGAAATATGTGCTGGGGCTGAAA ACAAACAAGTGGGCCACCATAATCC
Cmet AACCCGAATACTGCCCAGACCC TGATATCCGGGACACCAGTTCAG
MCP1 GCCCTTCTGTGCCTGCTGCT GCAGGTGACTGGGGCATTGATT
COX1 GGTTTGGCATGAAACCCTACACCT CCTCCAACTCTGCTGCCATCT
COX2 TGGAACATGGAATTACCCAGTTTGTTG TGTGATACTTTCTGTACTGCGGGTGG
HSP70 GTGGCTGGACGCCAACACCTT TTACACACCTGCTCCAGCTCCTTC
HSP27 GCTGACGGTCAAGACCAAGGATG TGAAGCACCGGGAGATGTAGCC
αB-crystallin GTGTTGGGAGATGTGATTGAGGTG CTGGGATCCGGTATTTCCTGTGG
Myogenin CTGCAGTCCAGAGTGGGGCAGT CTGTAGGGTCAGCCGTGAGCAG
Myf6 GGGCTCGTGATAACGGCTAAGGA TGTCCACGATGGAAGAAAGGCA
MyoD ACGAAGGCGCCTACTACAACGA GACACCGCCGCACTCTTCCC
Myostatin TGCTGTAACCTTCCCAGGACCA GCTCATCACAGTCAAGACCAAAATCC
Atrogin1 TGTTACCCAAGGAAAGAGCAGTATGGA ACGGAGCAGCTCTCTGGGTTATTG
MuRF1 TGGGGGAGCCACCTTCCTCT ATGTTCTCAAAGCCCTGCTCTGTCT
TNFα TTCCCCAGGGACCTCTCTCTAATC GAGGGTTTGCTACAACATGGGCTAC
TNFRI GGGAGGACAGCGCCCACAAG CACGAATTCCTTCCAGCGCAAC
TNFRII CCACTCGGAACCAGCCACAG CCATGGCCACCAGGGGAAGA
IL-1β TGCGTGTTGAAAGATGATAAGCCCA CAAATCGCTTTTCCATCTTCTTCTTTG
IL-1R GGAAGGGATGACTACGTTGGGGA CCAGCCAGCTGAAGCCTGATGTT
IL-6 GAGGCACTGGCAGAAAACAACC CCTCAAACTCCAAAAGACCAGTGATG
IL-6R CCAGGAGGAGTTCGGGCAAG GGGGTGGACACCTCGTTCTCA
  1. Abbreviations: RT-PCR real-time reverse transcriptase-polymerase chain reaction, RPLP0 large ribosomal protein P0, GAPDH glyceraldehyde-3-phosphate dehydrogenase, IGF insulin-like growth factor, HGF hepatocyte growth factor, MCP1 monocyte chemoattractant protein = CCL2, COX cyclooxygenase, HSP heat shock protein, MuRF1 muscle ring finger protein 1, TNF tumor necrosis factor, IL interleukin, R receptor
  2. The HGF primers are specific for the two largest splice variants including the SP domain